For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 126 bp
Wild Type =135bp
>chr4:133982746-133982880 135bp TATAGCAACCACTCTCCTCA TTCAGTTCCAGGGTTCAG
Sequence
Wt Sequence:
tggtctgcaggtttaaaggcattcttgggttggggatgcactggcaaatgtatttgatggtggccaatcaccaaccgggaggctgcgcgtggaagttcacggagagtgccacagagagacctgtgcttctgtctcctgcccacctagTGATGTCTCCGAGTCTCTGCTCGATAAGTGCCTCTATAGCAACCACTCTCCTCATCCCGACATCCTGATCCGGACTTCTGGGGAGGTGCGGCTGAGTGACTTCTTGCTCTGGCAGgtaggttgttttgaaacatgttattttggggttgggctgaaccctggaactgaagcagaacccattctccaccaatgtacgagcaaggcagagggtcaccacgtagaacaaccagtacctccaggttg
Mutant Sequence:
tttatttattgtaagtacactgtagctgtcctcagacactccagaagagggagtcagatctcgttacggatggTAGTATGATGTATCTTTTTAGACTTTGTTCTTTATGTATACTTATATGCACGTGTGAATGTTTGAATGTGTGTGTATGTTTTATACTATATATTCTCTGAAACTTGCCTTTTACATTTAACATTAGATTTTGGACATCTTTCCAAATCAGTGCATTTAGATTTATCTTTATTTTTAGAATGCAGTTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 72573 | TAT AGC AAC CAC TCT CCT CA | Wild type Forward | A | |||
| 72574 | TTC AGT TCC AGG GTT CAG | Wild type Reverse | A | |||
| 72575 | AGA TCT CGT TAC GGA TGG TA | Mutant Forward | A | |||
| 72576 | GGC AAG TTT CAG AGA ATA TAT AGT | Mutant Reverse | A | |||
| 72577 | Fluorophore-1 | CCG ACA TCC TGA TCC GG | Quencher-1 | WT Probe | ||
| 72578 | Fluorophore-2 | TGC ACG TGT GAA TGT TTG AAT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 72573 | 0.40 uM |
| 72574 | 0.40 uM |
| 72575 | 0.40 uM |
| 72576 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.