Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 116 bp
Wild Type = 100 bp
>chr19:46589330-46589429 100bp TGTAGCTCAGTAGTCATCCT GCTGCTTCTTCTTCCTGTTT
Large deletion: Mutant sequence with junction in uppercase
ccctgtccactctcacaaaaagcctgagaaggtaatggtacctcccacttgaaagctgaggtgaccgaggcctcgactaggtattcaagggtccctcCGtaggtgttgggagtggtgtcacagtggctcaggcagggccagggtctctttagcaagagactcgagtaattgggcttcaggactcgtgtgacctgtctcacccacattc
This mutation is a 2681 bp deletion beginning at Chromosome 19 position 46,587,902 bp and ending after 46,590,582 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 70803 | TGT AGC TCA GTA GTC ATC CT | Wild type Forward | A | |||
| 70804 | GCT GCT TCT TCT TCC TGT TT | Wild type Reverse | A | |||
| 70805 | GAA AGC TGA GGT GAC CGA | Mutant Forward | A | |||
| 70806 | ACT CGA GTC TCT TGC TAA AG | Mutant Reverse | A | |||
| 70807 | Fluorophore-1 | CCT CTA GGC CTA ATA CCC AG | Quencher-1 | WT Probe | ||
| 70808 | Fluorophore-2 | TCC CTC CGT AGG TGT TGG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 70803 | 0.40 uM |
| 70804 | 0.40 uM |
| 70805 | 0.40 uM |
| 70806 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.