Protocol 47718: Probe Assay - Sfxn2<em1(IMPC)J>Alt1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  116 bp

Wild Type = 100 bp

>chr19:46589330-46589429 100bp TGTAGCTCAGTAGTCATCCT GCTGCTTCTTCTTCCTGTTT

Sequence

Large deletion:  Mutant sequence with junction in uppercase

ccctgtccactctcacaaaaagcctgagaaggtaatggtacctcccacttgaaagctgaggtgaccgaggcctcgactaggtattcaagggtccctcCGtaggtgttgggagtggtgtcacagtggctcaggcagggccagggtctctttagcaagagactcgagtaattgggcttcaggactcgtgtgacctgtctcacccacattc

This mutation is a 2681 bp deletion beginning at Chromosome 19 position 46,587,902 bp and ending after 46,590,582 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
70803 TGT AGC TCA GTA GTC ATC CT Wild type Forward A
70804 GCT GCT TCT TCT TCC TGT TT Wild type Reverse A
70805 GAA AGC TGA GGT GAC CGA Mutant Forward A
70806 ACT CGA GTC TCT TGC TAA AG Mutant Reverse A
70807 Fluorophore-1 CCT CTA GGC CTA ATA CCC AG Quencher-1 WT Probe
70808 Fluorophore-2 TCC CTC CGT AGG TGT TGG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
70803 0.40 uM
70804 0.40 uM
70805 0.40 uM
70806 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.