For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 75 bp
Wild Type = 72 bp
>chr19:24834552-24834623 72bp GGCGATATGATTCCAAGGAA GACACAGGTGATCAAGAGAC
Sequence
Wt Sequence (deletion in lower case):
AGAGAAGTAGGAAGCAATCCTTTCCCTCTTCTTTGTCATTTCTAACACCTTCATCATTATAGTTTCTTAGTCAGGCTTAAAGTAAGAACTTATGTGAACTCAGCAAACCTGTTGGTCTTCAAAAGTAGAGATTTCAAACTACCAGAAACCAATGGTCCTTAAGTAGTTATTAGGTGGcagtggaagactagatatgagtaccccaggacttggagacttcaggtggaacagacaatcttcttttattcagctttcctaccacagagtctgtccgattcctttggctaggagattgaatacttcttgacagagcctggactactttcctgtctaaatgccttcaagtccatgaaccttggactgactatttcccgtattttttttttttagattggtcgactgattattgggcagaatggcatcttgtcgacccctgcagtctcctgcattatcaggaagatcaaggcagctggtgggatcattctaacagccagccactgtcctggaggaccagggggagagtttggagtgaagtttaatgttgccaatggaggtatgtggttccaaataagccttaacttaacactttttctcatatattatcactttctctgatggtaagcaggcaaagtggagaggaatcagctcagaaaaatccagtgagatgcccaaggcgatatgattccaaggaagaaccatatagcctctcagatgcACAGGGCTAGTCTCTTGATCACCTGTGTCCTTCAGCCAAGGGAAAGACTGGATAGTTGATACCGGAGTACTCTGGATTTTAAAGTTATAACATACCCTGGGGGCCATTTAAAACATCCCTTTCATTCTGCAAATAAAGGAATTGAAGCCCCAGGAGGCTGAGTTACTGTGGAAGACCACAAAGCTGCTCAGAGAG
This mutation is a a 538 bp deletion beginning at Chromosome 19 position 24,834,581 bp and ending after 24,835,118 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68659 | TTT CAA ACT ACC AGA AAC CA | Mutant Forward | A | |||
| 68661 | GAC ACA GGT GAT CAA GAG AC | Common | A | |||
| 68663 | Fluorophore-1 | AGT AGT TAT TAG GTG GAC AGG GCT | Quencher-1 | MUT Probe | ||
| 70523 | GGC GAT ATG ATT CCA AGG AA | Wild type Forward | A | |||
| 70524 | Fluorophore-2 | TAT AGC CTC TCA GAT GCA CA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68659 | 0.40 uM |
| 68661 | 0.40 uM |
| 70523 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.