For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:93883342-93883467 126bp GCAGGATGGACTGCTTAGATA GCCACTGTTCTGACACTCATTT
Mutant= 100 bp
Wild Type = 126 bp
Sequence
Wt Sequence:gcaggatggactgcttagataatcatttcagttacatcttagcttccttcctcactggatggttcctgactaCcaagggcaagtttggaatctacctctttgtaaaatgagtgtcagaacagtggc
Mut Sequence: tttgatgcttgctctttacctgccggcggcttaccttttacccttGCcaagggcaagtttggaatctacctctttgtaaaatgagtgtcagaacagtggc
A 665 bp deletion beginning at Chromosome 11 position 93,883,396 bp and ending after 93,884,060 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68566 | GCC ACT GTT CTG ACA CTC ATT T | Common | A | |||
| 68567 | GCA GGA TGG ACT GCT TAG ATA | Wild type Reverse | A | |||
| 68568 | TTT GAT GCT TGC TCT TTA CCT G | Mutant Forward | A | |||
| 68570 | Fluorophore-1 | CCT TCC TCA CTG GAT GGT TCC | Quencher-1 | WT Probe | ||
| 70268 | Fluorophore-2 | CCT TTT ACC CTT GCC AAG GGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68566 | 0.40 uM |
| 68567 | 0.40 uM |
| 68568 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.