Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 98 bp
Wild Type = 90 bp
>chr1:119526483+119526572 90bp CCCATCTAGAGGCAGTACA AAGCAGGCATAAATGAGGAA
Large deletion: Mutant sequence with junction in uppercase
ccgggccacgtgactgctcgcacgtgttccggcccctcggagctgcggtctggagcctctaacacgcagcgggcggatgcccatctagaggcagtacagccttcgccATgatatgccagactaaactcacaggctgggcctttcagtgaaataagaaccatatacccttgaattccactttgcttttttcttgtgttcatccagtcctggaattggaaacaggtccccctc
This mutation is a 1,036 bp deletion of Chr1:119,526,512-119,527,547 (GRCm38/mm10)
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 70193 | CCC ATC TAG AGG CAG TAC A | Common | A | |||
| 70194 | AAG CAG GCA TAA ATG AGG AA | Wild type Reverse | A | |||
| 70195 | TGG AAT TCA AGG GTA TAT GGT | Mutant Reverse | A | |||
| 70196 | Fluorophore-1 | CTG TTC CAG GAC TTC AAC C | Quencher-1 | WT Probe | ||
| 70197 | Fluorophore-2 | CCT TCG CCA TGA TAT GCC AG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 70193 | 0.40 uM |
| 70194 | 0.40 uM |
| 70195 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.