For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 83bp
Wild Type = 103 bp
>chr10:5841140-5841242 103bp AGTTTCCCAGCCATGTTAAA GAGAAGAAGTACCTGTCACAT
Sequence
Wt Sequence (deletion in lower case):
CTGCCTCTGCCTCTGCCTCTGCCTCTGCCTCTGCCTCTGCCTCTGCCTCTGCATGCGCCACCACTGTTTGGCCTAAATCTTTCTAAAATGAAAAGGTGAAAAGCAATCTTAGATCACCACTTAGGCAAAACCTGGACCAgtagagggcagcacaggactatacatttctgccagcatgtacacatagatgttgctcctaatgacttcattttctctgcagccaaaaccccactgcagatgaagtcttgtcctggtctcagaattttgacaagatgatgaagactcctgcaggaagaaaccttttccgagagttcctccgaacggagtacagtgaagagaacctactcttctggctggcctgtgaagacttaaagaaggagcagaacaaaaaggctgttgaagaaaaggccaggatgatatacgaggattacatttctatactgtcaccgaaagaggtaagaagccaaagggcacttcccttcagagtttcccagccatgttaaaggctagatgctttaacacctagcacccacagtgcttcGGTTATTTATCTCTGGCTAAATGGTATGTGACAGGTACTTCTTCTCCATAACTAATTCCATGCAGAAGTAAGTAACTTACTATGTTTTAAAGTGGGCGATGCTTTTCAA
This mutation is a 402 bp deletion of Chr10:5,841,186-5,841,587 (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 70026 | AGT TTC CCA GCC ATG TTA AA | Wild type Forward | A | |||
| 70027 | GAG AAG AAG TAC CTG TCA CAT | Common | A | |||
| 70028 | GCA ATC TTA GAT CAC CAC TTA G | Mutant Forward | A | |||
| 70029 | Fluorophore-1 | CTT TAA CAC CTA GCA CCC AC | Quencher-1 | WT Probe | ||
| 70030 | Fluorophore-2 | CCT GGA CCA GGT TAT TTA TCT CTG GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 70026 | 0.40 uM |
| 70027 | 0.40 uM |
| 70028 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.