Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 99 bp
Wild Type = 110bp
>chr15:81946469-81946578 110bp ACACAAGTTGAAAGGACAGT CATGCTAAACTGTGTGATTAGT
MUT Sequence (large deletion, junction in UPPER case):
agaagcagggctggctctttcaggacttcctgtggccttagcctagagccccagagccacagcagtgatcatcagggttctgtgataatggttatcagctgatccctgcctgaccccagctcactgctcccagcatcCCctgcctcggtatcctcaccagaaaaacaaactaatcacacagtttagcatgtaggaggctttagctttaatccccagcaacaaaacaaaggactgtcggaatgtttgtttgcggagctaatgccaccttaaaaccaggcgtgagcacactgtggtggcgcacacctttgatcccagggcttgaaagacagaggcaggggg
This mutation is a a 2,287 bp deletion of Chr15:81,946,521-81,948,807 (GRCm38/mm10)
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 70012 | ACA CAA GTT GAA AGG ACA GT | Wild type Forward | A | |||
| 70013 | CAT GCT AAA CTG TGT GAT TAG T | Common | A | |||
| 70014 | TTA TCA GCT GAT CCC TGC CT | Mutant Forward | A | |||
| 70015 | Fluorophore-1 | ACT CCC GAA GAC ACT CAC | Quencher-1 | WT Probe | ||
| 70016 | Fluorophore-2 | CCA GCA TCC CCT GCC T | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 70012 | 0.40 uM |
| 70013 | 0.40 uM |
| 70014 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.