For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 66 bp
Wild Type = 96 bp
>chr8:72661989+72662084 96bp GGATTGTCTCCACACCAG ACTATGAAGGAAGCACACTG
Sequence
Wt Sequence (deletion in UPPERCASE; insertions with carrots ^g^ (g insertion):
tgtgccaccacacccgtccctcctccatcttgtagctgttgcaggctccccatttgtctgagacagccttcctttgctgtccacattggcctaaatctcccacacttcccacctcagcctccaccctgagtgtggggattgtctccacaccagcttctttgtgt^ttga^AATAGTCACACCATCAGGTGACCATGAACACCAAGCTGGTGTCCCTTCAGTGTGCTTCCTTCATAGTCCCAGAGTTCAGTGTCAGGTGGGATTTGAACCCATGCCTGTCTCTGTCTCCCTCCCTCCCAGGCCCTCCTGGGTGACCAGTACGGCCCCTGCCCGGTTCCCCGGAGGATTGAGGAAAAGGAGTGGGAGGCACTAAGAGCTCAGCTGACCTCCAGGCCTCGAGATCTGGAGCTGGTGACCAGACATTTCCAGAGAGACGACAACACCATTCCTCCAACCTACGTCTTGCAGCCTTCAGGCTCACTGGTGGTCCCAGGGCCTGAGGAGGCCACCTTAACCTCTGTCCTGAGAGGTGGAGCCCAGGAGGCCTGGAGGCTAGGCCTCATCAGCCAGGAGCAATGGATGTGCTATCACCGATCAGGTGAGACCCAAGGAACCTCCAGAGGTCCATGGGACACAGGACACCCAAGCCAACATGTCCCCTGTGATCTCAAACGCAAGTGAAGTAGTGTATCATCTCAGTGAATGTTAACCCTGCTTggctctcaagagactgcataaccttggccaatgttagtctctaggaccctcttcttgacccctggctctgccctcctatctcccagggtgaccgccatctcagtttgcctgggactgaaattgttcaggaatgcaatacattccattccttccc
This mutation is a 546 bp deletion beginning at Chromosome 8 position 72,662,018 bp and ending after 72,662,563 bp (GRCm38/mm10). There is a 4 bp insertion at the deletion site (TTGA).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 69221 | GGA TTG TCT CCA CAC CAG | Common | A | |||
| 69222 | ACT ATG AAG GAA GCA CAC TG | Wild type Reverse | A | |||
| 69223 | CAT TGG CCA AGG TTA TGC A | Mutant Reverse | A | |||
| 69225 | Fluorophore-1 | CTT CTT TGT GTT TGA GGC TCT CA | Quencher-1 | MUT Probe | ||
| 69863 | Fluorophore-2 | AAT AGT CAC ACC ATC AGG TG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 69221 | 0.40 uM |
| 69222 | 0.40 uM |
| 69223 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.