For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 96 bp
Wild Type = 94 bp
>chr7:122671643+122671736 94bp GGATGCTGACAAAAGGAGAT GGGTAGATTCAGTGACAGAC
Sequence
Wt Sequence (deletion in lower case):
CTGACCGCGGCAGTGATGTGGACCAACCCCCTGGAGCCCGCACCCTCCCGAGGGCCATAGAGGACTCGGGGAACTGGAGAGAGCCCAAGACAGGAAATCCCAGCTTTCCCAAAGTCCCCGTGGATGCTGACAAAAGGAGATCTGGATTTttggaagaggccgtcctaggttacccagctgcagagtgattctcccgtctgtcactgaatctacccctccaacccccagccgttcagagtaccatgaagaattatgaggatgtgtgacagaggtatccagatgttgatcactactgtaggagccttcgcagcttttagtttaatgaccattgcagtgggcacggactactggctatattccagaggtgtgtgcaggactaaatctacaagtgacaatgaaaccagcaggaagaatgaagaagtaatgacccactccgggTTGTGGAGGACCTGCTGCTTGGAAGGTACTTACAAATTCCTCTCACTGGCTCTGAATGATCTGCTTCTAATGTCCTGACATGTGTTGGGGGGGAAATAGAGGCAATGGAGGGGAAGAAAAATAGTTTTAATTGTTGTTGGAAATATGTGAGGGTCCAGACTATGCTTCCACGGAGCCTGGTGCTGTGTGGATGGAAGGGTTGGGTCTTGTTG
This mutstion is a 289 bp deletion beginning at Chromosome 7 position 122,671,671 bp and ending after 122,671,959 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 69106 | AGA AGC AGA TCA TTC AGA GC | Mutant Reverse | A | |||
| 69107 | GGA TGC TGA CAA AAG GAG AT | Common | A | |||
| 69109 | Fluorophore-1 | TTT TGT GGA GGA CCT GCT GC | Quencher-1 | MUT Probe | ||
| 69232 | GGG TAG ATT CAG TGA CAG AC | Wild type Reverse | A | |||
| 69233 | Fluorophore-2 | CAG CTG CAG AGT GAT TCT C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 69106 | 0.40 uM |
| 69107 | 0.40 uM |
| 69232 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.