For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 121 bp
Wild Type = 141 bp
>chr7:99626189-99626329 141bp ACATCGAGGTAGTAGAGGAC CGTGATTGAGCTGTAGTGAG
Sequence
Wt Sequence (deletion in lower case):
AGCTGGAGGACGGACCGGTCGGAACTGTCAGCTGCTCCGGGTCAAGGTCTAGCCCACAGCCACCTTCCCGTGCCACCCCCATCCCATCATCTCCAAACGCTCCCAATTCACTGGTGAGCGCTGCGGGCCGGGGGCTGGATGCGGGGACGGCCGCGATGGCCCCGCGCGCGGgacagcgggggctctggagcccgctgccagggctgctgctcttggcggcggcgctgagccggcccgccgcgccctgtcccttccagtgttactgcttcggcagcccccggttaatgttgcgctgcgcgtcgggcgcggagctccggcagccgccccgggacgtgccacccgacgcgcgcaacctcaccatcgtgggcgccaacctgaccgtgctgcgcgccgcagccttcgcgggagggggcgagggggcgacggacggcgtgcgcctaccgctccttaccgcgctgcgcctcacacacaacaacatcgaggtagtagaggacggtgccttcgacgggttgcccagcctggcggcactcgacctaagccacaacccgctacgcgccctgggctaccgcgcctttcgcgggctgcctgcgctgcgctcactacagctcaatcacgcgctggctcgaggcagccccgggatgctggatgcactggacgccgctctggcccccctggccgagcttcgcctgctgggcttggtaggcaacgcgctgagccgcctgccactcgccgcgctgcgcctgccccgcctggagcagctggatgcgcgtgtcaacgcgctggccggcctgggcccggacgagctgagcgcgcttgagcgcgatggcgacctgccccagccgcgcctgctgctggcggacaacccactgagctgtgggtgcacctcgcgccccctgctggcctggctgcacaacgccaccgagcgcgtacccgacgcgcgccgcctgcgctgcgcttccccgcgcgtactgttggaccggcctctgatagacctggacgaggcgcgactaggttgctccgacggcgatgcacacgagagcggggaagggatagacgtcgccggcccggagttggaagcctcttacgtcttcttcgggctggtgctggcactcatcggcctcatcttcctcatggtgctctacctaaaccgccgcggcatccaacgctggatgcacaatttgcgcgaggcctgcagagatcagatggagggctaccactaccgctacgagcaggatgcagacccacgccgcgcgcctgctccggccgcccctgccggctcccgggccacttctccaggctcggGTCTCTGAGCATCACCTCCCTAGTGGGAGGCTGTTCCTATCAGCTGATGACTTTACTTGGGCCATGCAGCCTTTCTCTGCCTGGCCTGGGCCCCGGAGATAACACACTTACGAGTTTGGATCTCTGAGACCTTTGGATCAATCGTAGTATCTCTCCCATACAGAAATTCCAAGGTGTACTCTTTCCCTGGCCTTAGAGTTTCCAGATCAAAAACCCAGAAATCTGTTTTCAGAAACAAATCCTGCCTGCCGGTCCTTA
This mutation is a 1131 bp deletion beginning at Chromosome 7 position 99,625,502 bp and ending after 99,626,632 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 69011 | ACA TCG AGG TAG TAG AGG AC | Wild type Forward | A | |||
| 69012 | CGT GAT TGA GCT GTA GTG AG | Wild type Reverse | A | |||
| 69013 | CCC AAT TCA CTG GTG AGC | Mutant Forward | A | |||
| 69014 | GTC ATC AGC TGA TAG GAA CA | Mutant Reverse | A | |||
| 69015 | Fluorophore-1 | ACT CGA CCT AAG CCA CAA | Quencher-1 | WT Probe | ||
| 69016 | Fluorophore-2 | CGG GTC TCT GAG CAT CAC CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 69011 | 0.40 uM |
| 69012 | 0.40 uM |
| 69013 | 0.40 uM |
| 69014 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.