For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 149 bp
Wild Type = 130 bp
chr4:129341662+129341791 130bp TGTATTGTCGCAGGAAGAGC TGTAAAGCCACTCGTCCAAA
Sequence
Wt Sequence (deletions in lower case):
CGTAATTCCATTTTTTTCCTTTGATTTTGTTGTTTTAAATCTGAAATGATgatttacaaacatcctatatgggtgtcgtcaaattagacatgtagtttatatttatgaagctgattttcttttgctttactgtgggattttctgtcttgtaattgattatgcacatactgtggcctcttttatttgttgtaatttaaactttgtaatttttaggttacacgcatggggagacactctggaggaagcatttgaacagtgtgccatggccatgtttggttacatgacagatactgggactgtggagcccctccgcaccgtggaagtagaaacccaaggtaactgctctattcacaaggaaaagttatggcatgagtggacgttgttcttcatgatctgagtgtattgtcgcaggaagagcctcagggtggattctgaactttactaatgtcgcctgctgtggtcctttccactctgtaggggacgacctgcagtctctgctgtttcactttttggacgagtggctttacaagttcagcgctgatgagtacttcataccccgggtaagcgcaaggctttgctttttggggttttttttgctgagcaagtaggctgttggttcacattttaaaattgaacaagtaattcaaggtaagacatagggtccaaaagccagtccattgagatagtgagataatgttgagttatataatttacagggtttTTAAAAGAAGTTTTGTTTAGTTTATGTATAGTTGTTTTGCCTGCATGCACATCTGTGCACCAAGTGCATGCAGTGTCAGTGAAGGCCTGAAGAGGGCATCATAG
This mutation is a 671 bp deletion beginning at Chromosome 4 position 129,341,314 bp and ending after 129,341,984 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67882 | TGT ATT GTC GCA GGA AGA GC | Wild type Forward | A | |||
| 67883 | TGT AAA GCC ACT CGT CCA AA | Wild type Reverse | A | |||
| 67887 | Fluorophore-1 | CTG AAC TTT ACT AAT GTC GCC TGC | Quencher-1 | WT Probe | ||
| 68745 | GCT TGG TGG CAA GTA TCT TT | Mutant Forward | A | |||
| 68746 | GCA GGC AAA ACA ACT ATA CA | Mutant Reverse | A | |||
| 68747 | Fluorophore-2 | CTG GCC CAA GCG TAA TTC CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67882 | 0.40 uM |
| 67883 | 0.40 uM |
| 68745 | 0.40 uM |
| 68746 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.