Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr12:69760226-69760326 101bp GGATTTGTGGGCTGATGG CAGCTCAAGAAACCCAATCC
Mutant= 100 bp
Wild Type = 100 bp
Wt Sequence: ggatttgtgggctgatggcctgtggatccagaggaggctgtgTctcccgggatttttcagtcccaaagcctgcccccgtctggattgggtttcttgagctg
Mut Sequence: ggatttgtgggctgatggcctgtggatccagaggaggctgtgTCgttttttgtttttggtttttgtttttaatttgtaaaatgtgaggaagaaggaaccc
A 396 bp deletion beginning at Chromosome 12 position 69,759,888 bp and ending after 69,760,283 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68571 | GGA TTT GTG GGC TGA TGG | Common | A | |||
| 68572 | GGG TTC CTT CTT CCT CAC ATT | Mutant Reverse | A | |||
| 68573 | CAG CTC AAG AAA CCC AAT CC | Wild type Reverse | A | |||
| 68574 | Fluorophore-1 | CGG GAT TTT TCA GTC CCA AA | Quencher-1 | WT Probe | ||
| 68575 | Fluorophore-2 | AGG AGG CTG TGT CGT TTT TTG TT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68571 | 0.40 uM |
| 68572 | 0.40 uM |
| 68573 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.