For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:92619213-92619373 161bp TTTTTCGTGAGCCATCTCAG AATTAAAAACTGGGGATGCTG
Mutant= 170 bp
Wild Type = 161 bp
Sequence
Wt Sequence: tttttcgtgagccatctcagcagttgagaaactggtttctccttttcttttgcttctgcctcttcctccttcctcagtattcTggtgagattcagctaagggcttatatatacaggtaaattaggtacctgggtactggccagcatccccagtttttaatt
Mut Sequence: aaaggcgtgcaccaacaggccctgaagtaattttctttttaaaagactgttttataacaattcactgaaaacttcattgttaatgtgttCTggtgagattcagctaagggcttatatatacaggtaaattaggtacctgggtactggccagcatccccagtttttaatt
A 575 bp deletion beginning at Chromosome 7 position 92,619,292 bp and ending after 92,619,866 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68551 | AAT TAA AAA CTG GGG ATG CTG | Common | A | |||
| 68552 | AAA GGC GTG CAC CAA CAG | Mutant Forward | A | |||
| 68553 | TTT TTC GTG AGC CAT CTC AG | Wild type Forward | A | |||
| 68554 | Fluorophore-1 | TGC CTC TTC CTC CTT CCT CA | Quencher-1 | WT Probe | ||
| 68555 | Fluorophore-2 | TGT TAA TGT GTT CTG GTG AGA TTC AGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68551 | 0.40 uM |
| 68552 | 0.40 uM |
| 68553 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.