For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr2:93956497+93956583 87bp AGCTCTGCAGGAACGACTTC TGACCTTCGACGAGATCCA
Mutant= 71 bp
Wild Type = 87 bp
Sequence
Wt Sequence (deletions in lower case):
CGCGGGGCGCGCACGCTTTAAATGGCATTCGCTGTCATCcgagcttgcagccgtgtgggcagaggcgggctatataagcggctaggcgggccgccgcggggtacacggcgacagcgacagcgaccgcgacaggggcggcagggagcctctcgaagcatcgccgagcagcgcagcgcagccccgcgccccccgacgggcccgcccgcccgctatccctctccagcagcgtcggctcgggccagcgaggcccgccgccaccccgcagcagatttggatcccccgcccggagagccccaggctgtcgcctcccgggggaccccggagccgcggccgcccccggagagcccgggcgccccgccaccccccggctccgcacccgccgacggcgccatggcggccgccaagcccggcgagctcatgggcatctgctccagctaccaagcggtgatgccacacttcgtgtgcctgaccgatgagttcccgcagccggtgcggcccgccaagctgcccaagggcaagggccggctgcggcggccacgccagtcccgcttcaagacgcagccggtgaccttcgacgagatccaggaggtggaggaggagggggtgtccccgatggaggaggagaaggccaagaagtcgttcctgcagagcttggagtgcctgcgccgcagcacgcagagcctgtcgctgcagagggagccgctcggcagctgcaaactgaggaacagcctggactccagcgactcCGACTCGGCCCTGTGAGGCGGTAGCCCGCTTGGGGACTTGCTCCACCGCCAAGCGCCGGGA
This mutation is a 707 bp deletion beginning at Chromosome 2 position 93,956,403 bp and ending after 93,957,109 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67387 | ATG GCA TTC GCT GTC ATC | Mutant Reverse | A | |||
| 67388 | CTT GGC GGT GGA GCA AGT | Mutant Forward | A | |||
| 67391 | Fluorophore-1 | ACT CGG CCC TGT GAG GCG | Quencher-1 | MUT Probe | ||
| 68508 | TGA CCT TCG ACG AGA TCC A | Wild type Reverse | A | |||
| 68509 | AGC TCT GCA GGA ACG ACT TC | Wild type Forward | A | |||
| 68510 | Fluorophore-2 | CGA TGG AGG AGG AGA AGG CC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67387 | 0.40 uM |
| 67388 | 0.40 uM |
| 68508 | 0.40 uM |
| 68509 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.