For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 72 bp
Wild Type = 97 bp
>chr17:56696721+56696817 97bp CTGACCATGAGGATGGAAACT CTACCTGGCTCTGGAGGATG
Sequence
Wt Sequence (deletion in lower case):
GCTGGAACTGGAGGGCCATGGAACCTCTTTCTAGTTGAAGAAGGGTCCCGGCAGCCTGGCACAATCTCTGAACATTTTGGCCCAGACATCAGAACTTGTTTGTATTGGAACTGACAACCTAGAAGCAGGCGTGCATATGTGCTATAGAATGCTCTAGGGTGAGCATGGGAGCCAGGATGCCCTTGTCCCCAGACGTCCACACTGGTGTAGGCGTTGCTGAGGGCCatgctaattccctaggcaggccatggatcattggacctgacctatgtagggccatccttagcccctggcagggcacaggggagttggggacacaggtttggagcacttggggcctctcaccgcttctgtgttctcattgcagagatctgctggcagctccagtcccgaagccggagaaggtaaggaagtctctagaacatgagccaaatcctggaagcaaacttgaacactctctgactccaccctctctgtgtctagattctgaccatgaggatggaaactactgcccccctgtcaagcgtgagcggacatcctctctaactcactcaggtaagcaacatcctccagagccaggtagtgccagccccaagggtgtgatacctgaggccccacctaggctaaggaaagctgacacgtttgccataaggggaagttgggaggttccctgtcaagccctgtgggtacatcacctgtgaatctagctgtctttgcaaggacatggtgttggtgtggactggacgggatagtattctcacccactaggtaccatgtacatgcccatgcccagcgggagagcattcgttcatctgtgctcccagctcagacattgttggtagtcagactgaggggcaccatacacgtggatgccagcctccaggcttcaaccagtgcaggagtggggctggatctaggctgagagagtctggggatgctcatttggaggcaggcaaagtccagcagctcttttcacacataggcacccctcaggttaggagtgattgctgcctggatggttaggagtgattgccctgaagagctagaccatagagtgtcctggtctcTGCTGGTTCTGGTTCTGGTCTTGGTAGACCATCTTGGGCAGCAGGCATCACTTCTGCTCTATGGAGGAGGTCTCCCTCCTTGTCCCACGCCTAGAGCATGGTGGTCCTGCAAAACAGGCATTGCAGTCTTTTTGACAGCTGTACACCACCTTGGTTTAAAGGCCCCATGCCAGCTTGTGGGTGTGTAGAGGTAGCACAAAGGGGATCCCCAGCCTTGTTGTCCTGCCTGCCTT
This mutation is a 842 bp deletion beginning at Chromosome 17 position 56,696,460 bp and ending after 56,697,301 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66573 | CTA CCT GGC TCT GGA GGA TG | Wild type Reverse | A | |||
| 68418 | CTG ACC ATG AGG ATG GAA ACT | Wild type Forward | A | |||
| 68419 | CCA CAC TGG TGT AGG CGT TG | Mutant Forward | A | |||
| 68420 | TGC TGC CCA AGA TGG TCT AC | Mutant Reverse | A | |||
| 68421 | Fluorophore-1 | TCC TCT CTA ACT CAC TCA GGT AAG C | Quencher-1 | WT Probe | ||
| 68422 | Fluorophore-2 | CTG AGG GCC TGC TGG TTC TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66573 | 0.40 uM |
| 68418 | 0.40 uM |
| 68419 | 0.40 uM |
| 68420 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.