For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 93 bp
Wild Type = 91 bp
>chr17:25122711+25122801 91bp GGTGACCTTAACACACCTTCAGA GCTCTGTTCCACCAGGCTCT
Sequence
Wt Sequence (deletion in lower case):
GCCCACATTTTACACTGTGCAGCTATGGGGCCTGAGGACAGTTACCTGCTTTGTACCTGGCCCTTTGGGACTAGTCATGATAATCTCCACACATGTCCTAGCATGGTGACAAGGATCAAATTGTTCAATTTATAAACAGAACCATCCATAGACTTGGATGTAGATAGAATAGATACTTCTGAAGTATTCTTAGGGTAGCCTCAGCCTAACCCCATAAGAGCTGTGTTCTCTTTACAGTTTCAGAGATTCCaacaggtgaccttaacacaccttcagaacattgccaacaactacaatgtttaccacaatatggatgttcgcttccagagcctggtggaacagagccaagccgtagctctagcgatgaatcagtctcaagctgccatacaaggagatgtggcccatttaaagacctggtataggaagagccagcgaaggagccagaaggtagatgcccgacttcaagccttggacctctccctgagcacaaagagcaggcagtgggtagagaaggaaggggagcaaaaggcacagagggaggctattgcaagcctggccctaagcgttcaggcactacaggatgcactggccagccttacacagcaagtccacagccagggtgccaggcttgctgctctggagggacagacacagagggcctcctctggtactgtggccctggggttgaccacagcccccaaccccacccagcttgctcagcgaggcccaggatccttgcaactgtggagggaccgccaggtagccaagtcttcaccccaacacaggagttcccctcatgacgtcactgtccacgttcaggagatgcagaagttccaaaccccaagcagtcatcaagcagccccaccaaggacctaccaaggACCAGGAAACAGTAAGTGACACAAACCTGTCACCTCCCTATCAAGTTCCAGGTTTCCCTAGCAGTGTCTGAGGTTATAATGTCATTCCTGACACCTGTCACCCCAAAATCTCTTTCCCCCAAGGGCCACATACCTAACACCATAAGAGAGAATGGCCTC
This mutation is a 631 bp deletion beginning at Chromosome 17 position 25,122,707 bp and ending after 25,123,337 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68412 | GGT GAC CTT AAC ACA CCT TCA GA | Wild type Forward | A | |||
| 68413 | GCT CTG TTC CAC CAG GCT CT | Wild type Reverse | A | |||
| 68414 | AGC CTC AGC CTA ACC CCA TA | Mutant Forward | A | |||
| 68415 | AGG GAG GTG ACA GGT TTG TG | Mutant Reverse | A | |||
| 68416 | Fluorophore-1 | CAA CTA CAA TGT TTA CCA CAA TAT GGA T | Quencher-1 | WT Probe | ||
| 68417 | Fluorophore-2 | CAG AGA TTC CAC CAG GAA ACA GTA AGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68412 | 0.40 uM |
| 68413 | 0.40 uM |
| 68414 | 0.40 uM |
| 68415 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.