For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 97 bp
Wild Type = 91 bp
chr4:149753788+149753878 91bp AGGGAACATACCTGCAGAGC TTCCAAAGCCAAAGAGCAAT
Sequence
Wt Sequence (deletions in lower case)
TGGCTGTCAGCACTTTCTGGAATTTCTGGAAGGCATGAACATCCAGGTGcagtggcagcctgggtgtgagccagcctcttgtttccttgctggctaagatcattactctcttctgtggtctcctctttgggatagatggtgcagagggacctgtgtactttaaagtgcagtaatgctttaatggttttctctttttgtcctaccagggctgtgtactttgcatgttattccaaagccaaagagcaattcaatggcatcttcgtgcctaatagcaatactgtgcacattctctcagctggctctgcaggtatgttccctagcaagtgttgtttcgttttgctttcttttttttttttttctttccaggaattagatgttaactccctgcctcttttgaccctaaaaccatttttaaagctttgtattggagtttgtagaacatgactattagcagtttataaacaaattttacttttctgttcttcatcttcctgatttccctattgagttgtaatgtggagtgagagctgctttctttctgattccccaaGGTATCTGGGGTGCATCTGCCCTGCACAGCTCACTTGCACAGCAAGAATCAGGGTTTTATG
This mutation is a 501 bp deletion beginning at Chromosome 4 position 149,753,556 bp and ending after 149,754,056 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66317 | AGG GAA CAT ACC TGC AGA GC | Wild type Forward | A | |||
| 68199 | Fluorophore-1 | TGA ACA TCC AGG TGG GTA TCT GGG | Quencher-1 | MUT Probe | ||
| 68200 | AGC ACT TTC TGG AAT TTC TGG | Mutant Reverse | A | |||
| 68201 | AAC CCT GAT TCT TGC TGT GC | Mutant Forward | A | |||
| 68202 | TTC CAA AGC CAA AGA GCA AT | Wild type Reverse | A | |||
| 68203 | Fluorophore-2 | AAT GGC ATC TTC GTG CCT AAT AG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66317 | 0.40 uM |
| 68200 | 0.40 uM |
| 68201 | 0.40 uM |
| 68202 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.