For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 83 bp
Wild Type = 100 bp
chr8:75020252-75020351 100bp AACCCAAAGCTCAGAAAGGTT GAAGAACATGTCTGCCTACCAG
Sequence
Wt Sequence (deletions in lower case)
AGATTAAAAATTAAGTTATCCTCTTCAGTGAGGCATAAATGGAACTCCTCTgtgactggagaatgttaaatatactacttgggtcctaatcaatttttgctttgttctattttctttatggctctagccgaaaaagaagaacatgtctgcctaccaggtattctgtaaggagtaccgggtaaccattgtggctgaccatccaggtataggtaagaacctttctgagctttgggttttgtttggttttttggttgttttgttttgtttttactttctagtatctgaagcagtgcgtttgattaattcgatcactaggcagcttcaccctataacattagaatacaaattgaaactagctgcagtggcccataatgtcaggaaagctgaaacagcaaccacagcctaggttacagtatGTGCCCCTGTCTCAAACAAAAGATAAATGTATTTCCTCAGTTCTGCAAATCCTTTCATTTAC
This mutation is a 365 bp deletion beginning at Chromosome 8 position 75,020,168 bp and ending after 75,020,532 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68173 | AAC CCA AAG CTC AGA AAG GTT | Wild type Forward | A | |||
| 68174 | GAA GAA CAT GTC TGC CTA CCA G | Wild type Reverse | A | |||
| 68175 | GGA TTT GCA GAA CTG AGG AAA | Mutant Forward | A | |||
| 68176 | CTC TTC AGT GAG GCA TAA ATG G | Mutant Reverse | A | |||
| 68177 | Fluorophore-1 | AAC TCC TCT GTG CCC CTG TCT CA | Quencher-1 | MUT Probe | ||
| 68178 | Fluorophore-2 | AAG GAG TAC CGG GTA ACC ATT G | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68173 | 0.40 uM |
| 68174 | 0.40 uM |
| 68175 | 0.40 uM |
| 68176 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.