For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:26957812+26957900 89bp TCGCCACTAAAGCCATAGAA TTCAGGAAGAAGGCCTGAAG
Mutant = G, C, T
Wild type = A, G, C
Sequence
SEQ
gactctgtagaggctgaccctggggttttcctgggctccagGACTTCCTTTCAGACATGGCCATGTCAGAGGTAGACCGATTCATGGAGCGGGAACACCTCATATTCCGAGAGAACACGCTCGCCACTAAAGCCATAGAAGAGTAtATGAG(a/g)CT(g/c)ATTGGC(c/t)AGAAATACCTCAAGGATGCCATTGgtacttcaggccttcttcctgaacctccttgtgcccaccccacctcccctaaacctggcttcccagaccccatatccaccttcctcagagtcccaggaccccagcctccaaccatctgattctgccattcctccaacccagggagcccctgtccctgcccttggaaagtgtgac
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68074 | TTC AGG AAG AAG GCC TGA AG | Reverse | A | |||
| 68075 | Fluorophore-1 | CTG ATT GGC CAG AAA TAC CT | Quencher-1 | WT Probe | ||
| 68076 | Fluorophore-2 | AGG CTC ATT GGC TAG AAA TAC CT | Quencher-2 | MUT Probe | ||
| 68077 | TCG CCA CTA AAG CCA TAG AA | Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68074 | 0.40 uM |
| 68077 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.