For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 77 bp
Wild Type = 102 bp
>chr11:87981448-87981549 102bp CCTACCTGGCATTGTATCGTG GAGGAGGATTGCAACTTGACC
Sequence
Large deletion: Mutant sequence with junction in uppercase
ttaagagatccaactacctctgcctcctgggtgctgggatttaaggcaagtgccgccttacccagcctaagcttctctcttgtctgtgttcatgtgctcccaccatgtctatcccccGCggtgggtgggctaggtctgtgtttcatagggtgaggtagagctgtgctttcaatgagtataggaggtaggtggggcttcaggtatgaaattgggtgggtgagtcttttggggaagactgtggaactgtgaggta
This mutation is a 4626 bp deletion beginning at Chromosome 11 position 87,979,468 bp and ending after 87,984,093 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67953 | CCT ACC TGG CAT TGT ATC GTG | Wild type Forward | A | |||
| 67954 | GAG GAG GAT TGC AAC TTG ACC | Wild type Reverse | A | |||
| 67955 | TGC TCC CAC CAT GTC TAT CC | Mutant Forward | A | |||
| 67956 | TGA AAG CAC AGC TCT ACC TCA C | Mutant Reverse | A | |||
| 67957 | Fluorophore-1 | CAG CTA TGT CAC ACA CGA GAC AA | Quencher-1 | WT Probe | ||
| 67958 | Fluorophore-2 | CGG TGG GTG GGC TAG GTC TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67953 | 0.40 uM |
| 67954 | 0.40 uM |
| 67955 | 0.40 uM |
| 67956 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.