For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 94 bp
Wild Type = 96 bp
>chr14:30196707-30196802 96bp CGTATGGACTGTTGCTGCAT CCAAACCAAGGACTTACCCTAC
Sequence
Wt Sequence (deletion in lower case):
CAGGCAGGCTCACTGCTCATGCATCAGGGCAGGTGGCAAAATGCAGTAATGCAGCCTGGAATGACAGTACTTAACACTTAGCTGCTTATGAGAAATTCAGCATCAAAATTGAAATGTTTTCCTGGTCCACATGCAGGGTAGTGATTCTAGTTCTCATGATAACATTGTCTGttatcatgtctgtgcgtggtggggggggggtgcttctgtctctgagctattgattctgatcattgattctttctttctccacccttggtgtgttcctttctctttacaggaaaaagtagaatatgccttcctgattatttttacagtggagacatttctgaagattatagcgtatggactgttgctgcatcctaatgcttacgttaggaatggatggaatttactggattttgttatagtaattgtagggtaagtccttggtttgggaaaaacgtttatctgggaatggaggtgagggctggatggtaaagggaacacaagccttcttgggggaggtggttattcttatgcccgtgatggcatcaggatctagcaggggttcttttaatgctgacagggctgctgtcaatccctgggcagaggcctgggtgaagagctctcatgattggtgtgctTGGGGAAGTCAGTGACAGGCTGTTAGAGGAAGTCTCAGCCGCTAATGAGAGATGATTCACCTCACAGGGCCTCAAGTCTCCACAAATAGACCTGCCTGGCTGGTGGGTGGAGTCAGGTGAATGCAGCTCCTAAAAGCTAGCACCCTGCTAGTTA
This mutation is a 455 bp deletion beginning at Chromosome 14 position 30,196,518 bp and ending after 30,196,972 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67941 | CGT ATG GAC TGT TGC TGC AT | Wild type Forward | A | |||
| 67942 | CCA AAC CAA GGA CTT ACC CTA C | Wild type Reverse | A | |||
| 67943 | GTC CAC ATG CAG GGT AGT GA | Mutant Forward | A | |||
| 67944 | CAT TAG CGG CTG AGA CTT CC | Mutant Reverse | A | |||
| 67945 | Fluorophore-1 | CCT AAT GCT TAC GTT AGG AAT GGA T | Quencher-1 | WT Probe | ||
| 67946 | Fluorophore-2 | AAC ATT GTC TGT GGG GAA GTC AGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67941 | 0.40 uM |
| 67942 | 0.40 uM |
| 67943 | 0.40 uM |
| 67944 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.