For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 147 bp
Wild Type = 129 bp
>chr10:82867195+82867323 129bp CGATTTGCTGCTGTTGTTTG AGCATCCAGGAGGTTGCTTC
Sequence
Wt Sequence (deletion in lower case):
CCAACGGCTTACCTTTGCCATCTCGCGTCGCTACGGTTGGTAGGTAGTATGGTAGTAGCCCTGGGAGAGCTGTTACCTGCGCACCACCACCATGTCTAAAGAAAAATGTTCCCTTACTGGAGGCAAAGAGAAAAGAGGGGAGCTGGTCCGGAGTctggcatggcagcacctggtgaaacaggaggaggaagaggcagtgaagaaggaagaaaaggaggaaggggaagatgaggaggaggaaggctcagacagtagctccgatgacccgaaccccgagcccccctgcatgcacccagacctcctggagctggtggtggatcgagagaagtgccgcaaaatccgcaggcagtaccggcagctcatctacaccgtgcagcagaaccgcgaggacattgtgaacacggccagcgacacgctgagtgaggccctggaggaagccaacgtgctgtttgacggagtgagcagaaccagagaggcagcccttgatgcccagttcctggttttggcctctgatctgggtaaagagaaggcgaagcagctaaacaccgatatgaacttttttaatcccattgccttctgcgatttgctgctgttgtttgtgggcttcaattgggtagaagaggagtgtaaggaatttagcgactgcgatgatagcatagttctttccttttggggcatgttgcacgaggaagcaacctcctggatgctgcaagccgaaacgttccacttcatttttgggtcatttaaggcagaacgttctgcacgaaagccccggcttggatgtcacaaaagagcttgcaaaatggaaggaagtggagatatgcctacaaagttgaggaggctggatgtgcatgctaatcaggagacgacagaaaaagaagttgagagaatcttgggattgctgcaaacctactttcaaaagtaccccgatactccagtgtcatactttgagtttgtgattgatccaaactcattctctcgcactgtggagaatatcttctatgtgtcttttattattagggatggctttgcaagaataaggcttgaccaagacaggctgccaattctagagccaactaatgtgagccaggtggatgatgaaagtgattcctattcgtactgcaggaaacaaggcgttatatctttgagtttACAGGACTGGAAAAATATTGTCTCCACTTTTGAAATTTCAGAGGCTATGATCAAAAACTCATATTAAAGAGTTTTATTCATAGTATATCTTGAACTAACATCGAAAAATGGAATCTAAACAGAAGCACAAACTCTAGTAAACTATTTTCAAGAACAAATGAAA
This mutation is a 998 bp deletion beginning at Chromosome 10 position 82,866,770 bp and ending after 82,867,767 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67920 | CGA TTT GCT GCT GTT GTT TG | Wild type Forward | A | |||
| 67921 | AGC ATC CAG GAG GTT GCT TC | Wild type Reverse | A | |||
| 67922 | GGA GGC AAA GAG AAA AGA GG | Mutant Forward | A | |||
| 67923 | CCA TTT TTC GAT GTT AGT TCA AG | Mutant Reverse | A | |||
| 67924 | Fluorophore-1 | AAG AGG AGT GTA AGG AAT TTA GCG A | Quencher-1 | WT Probe | ||
| 67925 | Fluorophore-2 | CTG GTC CGG AGT ACA GGA CTG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67920 | 0.40 uM |
| 67921 | 0.40 uM |
| 67922 | 0.40 uM |
| 67923 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.