For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 141bp
Wild Type = 147bp
>chr8:123258345+123258491 147bp CTCGGATGATCGGGTAAAAG AGGAGAGATGGCAAACATGC
Sequence
Large deletion: Mutant sequence with junction in uppercase
attgagtgttcagtgaggaaggccagctcccgagtcccagtcccgctactcttgtgtttaggaagcctggtgcgggcacttctctgcttgcagtgttcggaggccagggggaagagtggcccttgcactgcgagtacctcgcttaTTggtcctttgctgttaacagtgtgctgcttctttaaaggccttagtcttgtactagctccagcatcgctagaacagagagaggatgctagatgcaggcgctatagggtaggaatgttgagaaagaaagagcagaagctctgtgtagggtgaggagaggacagtcctcccttggaagga
This mutation is a in a 2961 bp deletion beginning at Chromosome 8 position 123,255,684 bp and ending after 123,258,644 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67806 | CTC GGA TGA TCG GGT AAA AG | Wild type Forward | A | |||
| 67808 | GAA GAG TGG CCC TTG CAC TG | Mutant Forward | A | |||
| 67809 | CTA TAG CGC CTG CAT CTA GCA | Mutant Reverse | A | |||
| 67810 | Fluorophore-1 | CAT AGC CTA AAC TCT CTC CTT CCA | Quencher-1 | WT Probe | ||
| 67811 | Fluorophore-2 | AGT GTG CTG CTT CTT TAA AGG CCT TAG T | Quencher-2 | MUT Probe | ||
| 67862 | AGG AGA GAT GGC AAA CAT GC | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67806 | 0.40 uM |
| 67808 | 0.40 uM |
| 67809 | 0.40 uM |
| 67862 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.