For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:30274680+30274767 88bp TTTCTTGGTCCCTCCTGAGA CGGCTACTCTGCTTGCTTTT
Mutant= 80 bp
Wild Type = 88 bp
Sequence
Wt Sequence: TTTCTTGGTCCCTCCTGAGAAATCTATCAACAAAATTGGCCATGgtaagcaggggcctgggagTgcagaaaagcaagcagagtagccg
Mut Sequence: ggtggcttacaaccatctgtaaatggatctgatgccctcttctgctgTGCCCCCTTgcagaaaagcaagcagagtagccg
A 592 bp deletion beginning at Chromosome 2 position 30,274,151 bp and ending after 30,274,742 bp (GRCm38/mm10). There is a 7 bp insertion (GCCCCCT)at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66280 | GGT GGC TTA CAA CCA TCT GT | Mutant Forward | A | |||
| 66281 | CGG CTA CTC TGC TTG CTT TT | Common | A | |||
| 66282 | TTT CTT GGT CCC TCC TGA GA | Wild type Forward | A | |||
| 66283 | Fluorophore-1 | ATT GGC CAT GGT AAG CAG G | Quencher-1 | WT Probe | ||
| 67763 | Fluorophore-2 | TCT TCT GCT GTG CCC CCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 66280 | 0.50 uM |
| 66281 | 0.50 uM |
| 66282 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.