For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:52483482+52483601 120bp AGGCTTTCTAGTATCATGGGAAT TACGAGCATCGGGAGTTAAA
Mutant= 153 bp
Wild Type = 120 bp
Sequence
Wt Sequence: aggctttctagtatcatgggaatacctttacTgtggcagggatttattttctagaacttagcttttgtattaagttttctaaagcaagacacaaaaagaatttaactcccgatgctcgta
Mut Sequence: aggctttctagtatcatgggaatacctttacTGttttatgtcataaaaggatattgaatttgtattttttcaaaattttaatatatataaaatttatgtaaaatctatatacataatcatgttgaacagctgatgttttaaatactgatgcgg
A 4206 bp deletion beginning at Chromosome 18 position 52,483,514 bp and ending after 52,487,719 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66143 | TAC GAG CAT CGG GAG TTA AA | Wild type Reverse | A | |||
| 66166 | Fluorophore-1 | CAG GGA TTT ATT TTC TAG AAC TTA GCT | Quencher-1 | WT Probe | ||
| 67469 | AGG CTT TCT AGT ATC ATG GGA AT | Common | A | |||
| 67470 | CCG CAT CAG TAT TTA AAA CAT CAG | Mutant Reverse | A | |||
| 67471 | Fluorophore-2 | CCT TTA CTG TTT TAT GTC ATA AAA GGA TAT TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66143 | 0.40 uM |
| 67469 | 0.40 uM |
| 67470 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.