For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 112 bp
Wild Type = 146 bp
>chr2:153904671+153904816 146bp GTGGTCCTCACTGCTCTTCC TGATGGCTTTGCTGAGACAC |
Sequence
Wt Sequence (deletions in lower case):
GGTCCTAGTAGACTGGGCTAGAATCTTACTCAGACCTCTCAGTGAGGTGGTGGGGGTCATGGTGAGGGCCTGGGTCTTGACCTCTCagttctcattgtacatgtgtgtccccctcccagtatgaaggtaaaggacgtcctggagcctgttatcacattgaactttgtacctggagtgggcatctcccagtgtgtgtccacaggcatgaccatcactggcaagaggttggtgtgggagtaaagtggggcggggccgggggagaagaccacacccttgtctcacccttccatacgtaatcactgagtaccggcagttcattatgtgggtgctgggatctgaggtgactgtagacttgggttctgggttgacaggagccaggtgaagcgaggcacagactgaagggggtcggactgagcagtgggggaagaggccagggagagtctggggaggggattacagctgagcagtcttccagatgtgtaagagttcactgacataatgggaatggaaaggttgtttgtgtggctgtgagcaggccccatcctggcttttcaccatgtgtgggtagatcctgccctctgccttctcagattcaaaggttatgggcagatagagtggggatggaagtaccagtagcagagatacccagagtgctgggtcttccagtttcacaggagggaacatggaaatcaacgtggtcctcaacatcacagctactgatcggcttctgcaagatgaggaggcaggcacccctgtgttcaggagtgagggctgtgaggtcatcctggtcagcgtgaaaaccaacctgcctaacaagtaaggtgtcccgcgtctggggagcatggtggtcctcactgctcttccccatcattcctcttcccgagccactgatctcccataaccatgtctctttgtgtcctctgtccaatttggtgccattgatgcactgttcacatggttccccatgcctgtgtctcagcaaagccatcaacaagtttgtggacagtaccctgcgcaaagtcctccctggcctggtgagtggtcctgagcaagcttctatctcttcttggtgggactgctatggccagcgcatttgatcttgctgtgttgatagtggctacgaggagttcagggtctgtggctagctcaggaagaagaagcatagtgatcatctagtgatgtctgcacaggcataggtataggcagcacagcacgtgtgttcaacactgctcagatgaccagtccaaggatatgaatccttggTAATTTTGCACGCTGTGAAAGAATTTGGAGTCTAATCCAGACTCTGGTGTTGATAGTCCCATG
This mutation is a 1177 bp deletion beginning at Chromosome 2 position 153,903,913 bp and ending after 153,905,089 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65992 | Fluorophore-1 | TCT TGA CCT CTC TAA TTT TGC ACG | Quencher-1 | MUT Probe | ||
| 66822 | GTG GTC CTC ACT GCT CTT CC | Wild type Forward | A | |||
| 66823 | TGA TGG CTT TGC TGA GAC AC | Wild type Reverse | A | |||
| 66824 | Fluorophore-2 | TGA TCT CCC ATA ACC ATG TCT C | Quencher-2 | WT Probe | ||
| 67402 | TAG TAG ACT GGG CTA GAA TCT TAC TC | Mutant Forward | A | |||
| 67403 | GGA TTA GAC TCC AAA TTC TTT CAC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66822 | 0.40 uM |
| 66823 | 0.40 uM |
| 67402 | 0.40 uM |
| 67403 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.