For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 142 bp
Wild Type = 136 bp
chr5:110119411+110119546 136bp CACCTGTCCACAACCCTGTC CTGCCCTGTGGGAATTACTG
Sequence
Large deletion: Mutant sequence with junction in uppercase
actccaacttctttcataccccagtatttgtgacatctagcctgaggctttaaattatctgctttcccatcaagagaaaaccaagatttGCttaaacagctaaaaactgtacaatagatatgaaatattgtttaatgtttttaattgccatctagaagttgtattttaggatacagtatgtcatttcaatacacatacctaatgtgtaatgactagacctgggtaattg
This mutation is a 18,020 bp deletion beginning at Chromosome 5 position 110,111,841 bp and ending after 110,129,860 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67152 | CAC CTG TCC ACA ACC CTG TC | Wild type Forward | A | |||
| 67153 | CTG CCC TGT GGG AAT TAC TG | Wild type Reverse | A | |||
| 67154 | Fluorophore-1 | TGA AGC AGA ATT AGA GCT GCA T | Quencher-1 | WT Probe | ||
| 67155 | CCC AGT ATT TGT GAC ATC TAG CC | Mutant Forward | A | |||
| 67156 | CAA CTT CTA GAT GGC AAT TAA AAA C | Mutant Reverse | A | |||
| 67157 | Fluorophore-2 | AGG CTT TAA ATT ATC TGC TTT CCC ATC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67152 | 0.40 uM |
| 67153 | 0.40 uM |
| 67155 | 0.40 uM |
| 67156 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.