For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr4:57913258+57913376 119bp GAGTTGGAAGTCAGCCTGGT ATCCTTGATCCTTGCCATTC
Mutant= 119 bp
Wild Type = 119 bp
Fam=Mut
Hex=Wt
Sequence
Large deletion: Mutant sequence with junction in uppercase
aaccttagggtgaccttgtacacatcggagccccagcttttgaagttgcagaagctgtttctttttttttgtggtGCatgtgtgtgtgtgtaagctgagggtcaacttcaggtatcgttcctcaagagaggtccactttgggggtttggtggcgtttggtgttgctgttttgtgtatgtaagtgtgtgctggggttagtgtg
This mutation is a 8032 bp deletion beginning at Chromosome 4 position 57,908,342 bp and ending after 57,916,373 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67050 | TGA GGA ACG ATA CCT GAA GTT G | Mutant Forward | A | |||
| 67051 | TAG GGT GAC CTT GTA CAC ATC G | Mutant Reverse | A | |||
| 67052 | GAG TTG GAA GTC AGC CTG GT | Wild type Forward | A | |||
| 67053 | ATC CTT GAT CCT TGC CAT TC | Wild type Reverse | A | |||
| 67054 | Fluorophore-1 | TTT GTG GTG CAT GTG TGT GTG TGT A | Quencher-1 | MUT Probe | ||
| 67055 | Fluorophore-2 | TGG AGA CAA AGT TTC TTT GTG TAG C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 67050 | 0.50 uM |
| 67051 | 0.50 uM |
| 67052 | 0.50 uM |
| 67053 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.