For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr6:72957921-72958056 136bp GCCACCCATTATCACCTTGT GTCGGCAGGGTGTTCTTCT
Mutant= 139 bp
Wild Type = 136 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
ACCACCGGGAGCTGGTGCCTGCCACCCTCCACGCGGGATCGCAACGGGTTAGGAACGCGGGCcgagaagggcggagccccaggcagcctggagatgctgagcgccccccagcccccgcgcgcgctggccacgccctccgcgcgggctggccacgccctcgttgcggcgggcgagaggcggggcggggcgcggtgtatataagacgaggggcgggcgccgctcttttgtctcttgctgcagcaacgagagtgggagcacctggagcgcgagctcggaaggagaatccacggtaaggcacagcgccggccttggggcctaccctgggtggggtcgggccagtttatggctggcgggcgcgttccccttcggttgcaacaggcgacccggcggtttggaatcttctggggctagcaggccacgccctggggcttcggagggagggtgtggtggacgagtctaggatcctcggcctccgggctgcgggaacgcccaggactgggaatgccacgttgagaggcgttcgcggaaggcgcgggatccaggacgcgctggtcacccccaagcccctggccacccattatcaccttgtttcgcccatcagagttgtaagaaaatggcagacaagccggacatgggggaaatcgccagcttcgataaggccaagctgaagaaaaccgagacgcaggagaagaacaccctgccgaccaaagagagtaagtgtgccccgggttcccaccccagcgctcctcccttccctgctgtgccagcccggcacccccacccccatccggccactatcttcccaccccgaatctaaggccacagccacccttccagtcacacaaagcactttgtctcttccaaaccccttctctgtccgcaggcctcgtgggtgcctcacccacaccaggtttgtgggttgggtatggggggctgtaaggtagctccaatgaccacatccctcccttcgcagccattgaacaggaaaagaggagtgaaatctcctaaaagcctaggaagatttccccaccccaccccaccccgccccatcatctccaagaccccctcgtgatgtggaggaagagccacctgcaagatggacgcgagccacaagctgcactgtgaaacccgggcactccgagccgatgccaccggcccgcgggtctctgaaggggacccctccactaatcggactgccaaatttcaccggtttgccctgggatattatagaaaattatttgtatgattgatgaaaataaaaacacctcgtggcatggttggcgtggtctgaattttttagttgagtatgcgtgggcagagcggtctgggagtgagttgtgccgcAGGGAGAGAGGAGGGGACGTGGTAGAATGGGTGAGGAGGATGTATCGTTTTTATTTTTGTTTTACGTGCTTCTCGACATGCGGTTTCCTGGGTTCTCAGTTGCTTCGCCCTTAATGCGATCCATGTCAATTTTAACCCCATT
This mutation is a 1282 bp deletion beginning at Chromosome 6 position 72,957,282 bp and ending after 72,958,563 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67040 | GCC ACC CAT TAT CAC CTT GT | Wild type Forward | A | |||
| 67041 | GTC GGC AGG GTG TTC TTC T | Wild type Reverse | A | |||
| 67042 | Fluorophore-1 | AAT CGC CAG CTT CGA TAA GG | Quencher-1 | WT Probe | ||
| 67043 | GGC TCC TGG GTA CTA GGA AA | Mutant Forward | A | |||
| 67044 | CTC ACC CAT TCT ACC ACG TC | Mutant Reverse | A | |||
| 67045 | Fluorophore-2 | TAG GAA CGC GGG CAG GGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67040 | 0.40 uM |
| 67041 | 0.40 uM |
| 67043 | 0.40 uM |
| 67044 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.