For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr12:83977866-83977965 100bp GACAACACCTTTGAGCAGGAG CCCACCCACAGCTATTCTTG
Mutant = 106 bp
Wild Type = 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
GGTGTCTGCCAGTGGCTTCGAGAGGCACGGCTCCATCAACAGAGGGGAGCAGGGTGGCAGGAGACAGGTTCTCCCAGTGGCTCCATATTCAGATGGCACCATAGAGAGAATACTGGTCATTAGACACAGTTCTTCTAATGCTACCATGTAGGAGCGGAgctcaagtgggctagagtgaaccatggaccggaggggaaacatcttctacctcacccacttcccccctttccctctcacctctgctaaggttacctggttactccccacaagtacacacagctgaagccatgtccggcaacaacatgacagccgaggttatccaagcagagataagcaacatgcggcatatgactaagagccgattccggcaggtgaaccgcaaagccggggagtacgcttatgctacagacaacacctttgagcaggagatgtactttggtaatgctggggtgggagtacgggctgaggaaacgagggcatcttgggacaagaatagctgtgggtggggatgagagtctccgggtgcatctcccagggctagtataggattatggctagtggtgagcccacatttctttcccagcctctctttcttaccagggtggagcgggtggataggctcgtgagtcccagctgaCTTTGGGAGGACTGTTCTCTGTCTGGCCTGTCATCACTTTTAAGTATCCCCTCCCACCCACCTGACCTGCTGAGCTTTAAAAAACAAACAAACAAAAAAACAAAACAAAACAAAAAACCCCACAGGTCTTGGAGTCTGACAGATTTGTTTAAACACTGGCTTG
This mutation is a 479 bp deletion beginning at Chromosome 12 position 83,977,736 bp and ending after 83,978,214 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67034 | GAC AAC ACC TTT GAG CAG GAG | Wild type Forward | A | |||
| 67035 | CCC ACC CAC AGC TAT TCT TG | Wild type Reverse | A | |||
| 67036 | TCA GAT GGC ACC ATA GAG AGA A | Mutant Forward | A | |||
| 67037 | TGA TGA CAG GCC AGA CAG AG | Mutant Reverse | A | |||
| 67038 | Fluorophore-1 | TAG GAG CGG ACT TTG GGA GGA C | Quencher-1 | MUT Probe | ||
| 67039 | Fluorophore-2 | TGA GGA AAC GAG GGC ATC T | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67034 | 0.40 uM |
| 67035 | 0.40 uM |
| 67036 | 0.40 uM |
| 67037 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.