For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr4:154039684-154039798 115bp TTGACAGTGGGAGACAGATAGC GTTGGATTCTTCCCTGTGGA
Mutant= 113 bp
Wild Type = 115 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AGGTGGGGGTGGGATCTGAGTATATGTTAGGTGggagtgggatctgagtatatgctaggtgggagtgggatctgagtatatgctaggtgggcatggatctgagtatatgctaggtgggggtgggatctgagtatatgttaggtgggagtgggatctgagtatatgctaggtgggagtgggatctgagtatatgctaggtgggagtgggatctgagtatatgctaggtgggcatggatctgagtatatgctaggtgggggtgggatctgagtatatgttaggtgggagtgggatctgagtatatgctaggtgggagtgggatctgagtatatgctaggtgggcatggatctgagtatatgctaggtgggggtgggatctgagtatatgctaggtgggggtgggatctgagtatatgttaggtggggatagaattttaatttgacagtgggagacagatagctcattggacagatactggcttctgatggagggttgggaggggtggatactaccatggaagattccacagcagatccacagggaagaatccaaccctctctggcctcttcttcctccacagggagggtctttccattcagcaagagtgcttgtgagctcaactacccacggaagaggagtgagccttcagacccgagtcccaccggcagccccactgtggtcaagaagtcccagaggaccagaacgccctggtatatctcagtcatccatgagaaggtagggtcccaggctgtccccttgtcctgctcacccatgggtgtctagatagctgTGGCTTAAAACGACTCCCAGACACT
This mutation is a a 757 bp deletion beginning at Chromosome 4 position 154,039,447 bp and ending after 154,040,203 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66977 | TTG ACA GTG GGA GAC AGA TAG C | Wild type Forward | A | |||
| 66978 | GTT GGA TTC TTC CCT GTG GA | Wild type Reverse | A | |||
| 66979 | TGC TAG GTG GGC ATG GAT | Mutant Forward | A | |||
| 66980 | CAC TGG ATT CCT AGA AGG AGA TG | Mutant Reverse | A | |||
| 66981 | Fluorophore-1 | ATG TTA GGT GTG GCT TAA AAC GAC TCC | Quencher-1 | MUT Probe | ||
| 66982 | Fluorophore-2 | TTG GAC AGA TAC TGG CTT CTG AT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66977 | 0.40 uM |
| 66978 | 0.40 uM |
| 66979 | 0.40 uM |
| 66980 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.