For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 120 bp
Wild Type = 122 bp
chr1:156395483+156395604 122bp CGGATCAGCTCATGAAACAC ACTTGGCAGATAGCCTGTGC
Sequence
Wt Sequence (deletions in lower case):
TTTCTGGATATGTAAATCTGTGAATGAAAGAGCAGTAAGTCACCAAGATTCTATAAGCCATGCTcactttcagcgtatttgcctcttaaaatgacttggcagatagcctgtgctagcaccaaccctgtggcttacctctgctagatgcaccagctgctcaacgtgctgaagagggagcagagcatctacaacacagtgtttcatgagctgatccggcaggtcagcgtagactgtgcagacagaggagagctgctgtcaaaaatcaggttagagctgttaatggaatgtTCCAGGTTCCCCATGTCAAAAGCTGTATAATTAATTTTGTTTTTTGTTTTTT
This mutation is a 224 bp deletion beginning at Chromosome 1 position 156,395,410 bp and ending after 156,395,633 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66933 | AAG AGC AGT AAG TCA CCA AGA TTC | Mutant Reverse | A | |||
| 66934 | CCA AAG CAC TAT GGA AAA TGT AAC | Mutant Forward | A | |||
| 66935 | ACT TGG CAG ATA GCC TGT GC | Wild type Reverse | A | |||
| 66936 | CGG ATC AGC TCA TGA AAC AC | Wild type Forward | A | |||
| 66937 | Fluorophore-1 | AAC GTG CTG AAG AGG GAG C | Quencher-1 | WT Probe | ||
| 66938 | Fluorophore-2 | AAG CCA TGC TTC CAG GTT CCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66933 | 0.40 uM |
| 66934 | 0.40 uM |
| 66935 | 0.40 uM |
| 66936 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.