For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr17:3163013+3163136 124bp GAGATTATCCAGCCTCTTCTGG CAAGTCTGTACAACAGGCACGTA
Mutant= 127 bp
Wild Type = 124 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case, insertion ^g^):
CTGCTTCAGCTAAATTTAGCTTTCCTTTATCTTATATAGCTATCAGAAGTAACTACCCTATTACCTAAATTTAGGGATTACAGAATGGTTAAAAACAGTTTCAGGTTGGAA^cttc^tttaccactgaactattttagtctctctttgtaagtacaaataacctaaatgaaatgagtatgctaaagttttgaaagcagaaaaagttggaaacagtcttagagatgtaatgtgcaataaaaatattttaatcttctttatatcctatgctcagataatctgtgaaatgaattgtgataatattttgaaagccaaacatttgaaatcatttttctttattcttctagagtaaaatagtgagagtattaaacttatggcagaagaataatgtttttaagagtgagattatccagcctcttctggatatggcggcagggattcctcccccagttgtcacgcctgttttggccagcaccactgcagctatgagcaacactccaggtacgtgcctgttgtacagacttgttggagactcaagttacactgcttacccaatgttcacacgctatagggcagAGGAGTTTGTCCAGTGTTAAGAGACTTGAAGGCTGAGTGTGGTGGCAAGTGCCAACTGTTAGTCCTTACACTGGGCAGACAG
This mutation is a 457 bp deletion beginning at Chromosome 17 position 3,162,731 bp and ending after 3,163,187 bp (GRCm38/mm10). There is a 4 bp insertion (CTTC) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66730 | GAG ATT ATC CAG CCT CTT CTG G | Wild type Forward | A | |||
| 66731 | CAA GTC TGT ACA ACA GGC ACG TA | Wild type Reverse | A | |||
| 66732 | GCT ATC AGA AGT AAC TAC CCT ATT ACC | Mutant Forward | A | |||
| 66733 | ACT TGC CAC CAC ACT CAG C | Mutant Reverse | A | |||
| 66734 | Fluorophore-1 | TTC AGG TTG GAA CTT CAG GAG TTT GTC | Quencher-1 | MUT Probe | ||
| 66735 | Fluorophore-2 | CAG CAC CAC TGC AGC TAT GA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66730 | 0.40 uM |
| 66731 | 0.40 uM |
| 66732 | 0.40 uM |
| 66733 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.