For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr9:14356914+14356996 83bp CAGACAGCCTTCAGCAGACA ATTCCCTGGAAAGTGCTCAA
Mutant= 87 bp
Wild Type = 83 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case)
GCGGTGGTTCAGGTGACTCTCCCACCTCTGTGAGCAGGGCCTAATCTCAGCGCTGCCTTCTTTCTTTCAGATTGATGACCCTGACAGCAACctcgaggaggtcattgacgaggccaacgctctcacctcagtggacaatctgggaagcaagcaagccttgaatgcagactacattgactctgactatgaaatcggacagctgtacccatttcctcttaacagtgacctccagatggccacattcccgctcacaaattcagttccaatgacccagtctttccgggaacgatggcacatgaatctcaacagcctcatggaccgagccttgatcccacactgcagtgaaggcaaagacctgtatatcctcacgggggctgttccctcagagcacagagttaagggcaaagtgactatccctgaattcgtctggctggcagcttgctgtgcagtccctggagaaggctgggccatgggcttcatcaagcacacccaggacattgatgtcatagaagatgtgatgctgagagaccttgagaagctgcttcctcataagcctcaactgttccaggacaactgtggtgagatggagcaagatacagagaagatgaagaagattctggaagtggtcaaccaagtccaagatgaggagcggtctctgcagtctcaagagagaatgagtcccctcgccagcacccaaagccagaggtctgccctgctgtccccagaagcaccaccagagggagggagcagttttctgggacaagtcctgggtttccttgctaccccattcattaagcttttccagttaatttattaccttgttacagcggtcttaaggaatatagtccatctcctttggttggttgccaagcaggcaataaacactgttgagagttgcctataccatctaggcgaagccactgtctcatacctcgtggccattggacaagagctggtgagcattccctggaaagtgctcaaggttgtggccaaagtcatccgggccttcctccggatcctctgctgtctgctgaaggctgtctgccgagctctgagcatccctctccgagtccttgtggatgtagccactttccctgtgtatactgtgggggccattcccattgtgtgcaaggacattgctgtgggcctgggtggcaccctctcactcctctttgacactgcttttggcaccgtaggtggcttgtttcagattgtttttagtgtcttcaagcggattggctacaaggttactttagacaattcCGGGGAGTTCTAGAACTTAAAAACCTAGTAATGTCCATTGTGGTGAATTTTGATTTTCTCT
This mutation is a a 1172 bp deletion beginning at Chromosome 9 position 14,356,695 bp and ending after 14,357,866 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66715 | CAG ACA GCC TTC AGC AGA CA | Wild type Forward | A | |||
| 66716 | ATT CCC TGG AAA GTG CTC AA | Wild type Reverse | A | |||
| 66717 | TTC ACC ACA ATG GAC ATT ACT AGG | Mutant Forward | A | |||
| 66718 | GCT GCC TTC TTT CTT TCA GAT | Mutant Reverse | A | |||
| 66719 | Fluorophore-1 | CCC GGT TGC TGT CAG GGT C | Quencher-1 | MUT Probe | ||
| 66720 | Fluorophore-2 | CAA AGT CAT CCG GGC CTT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66715 | 0.40 uM |
| 66716 | 0.40 uM |
| 66717 | 0.40 uM |
| 66718 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.