For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr7:24625259+24625348 90bp ATCTCCCCATGCCTGTGTT GATCGTAGCTCAGGGTGCAG
Mutant= 85 bp
Wild Type = 90 bp
Fam=Mut
Hex=Wt
Sequence
Large deletion: Mutant sequence with junction in uppercase
actcaggcattagacttggcagcctgggcttgagccatcttgctggacgatgactcttcctgcatgggtggatgtctggttctcatgtttacatgccaactctttctgagccatgtcgccagcgttcattcgtcttatagCCtagacccgtgcgacagtgacccacccacttgaacacccagagcccagaatatcctttctttccagagggccccaggtgctccaggacttccttccctggacccatctccaggcttatgtagtc
This mutation is a 3288 bp deletion beginning at Chromosome 7 position 24,623,679 bp and ending after 24,626,966 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66679 | CAT GCC AAC TCT TTC TGA GC | Mutant Forward | A | |||
| 66680 | GTT CAA GTG GGT GGG TCA CT | Mutant Reverse | A | |||
| 66681 | ATC TCC CCA TGC CTG TGT T | Wild type Forward | A | |||
| 66682 | GAT CGT AGC TCA GGG TGC AG | Wild type Reverse | A | |||
| 66683 | Fluorophore-1 | TGT ATT CCG TAT GTT TGG ATT GCT | Quencher-1 | WT Probe | ||
| 66684 | Fluorophore-2 | CGT CTT ATA GCC TAG ACC CGT GCG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66679 | 0.40 uM |
| 66680 | 0.40 uM |
| 66681 | 0.40 uM |
| 66682 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.