Protocol 45873: Probe Assay - Phldb3<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

chr7:24625259+24625348 90bp ATCTCCCCATGCCTGTGTT GATCGTAGCTCAGGGTGCAG

Mutant=  85 bp

Wild Type = 90 bp

Fam=Mut

Hex=Wt

Sequence

Large deletion:  Mutant sequence with junction in uppercase

actcaggcattagacttggcagcctgggcttgagccatcttgctggacgatgactcttcctgcatgggtggatgtctggttctcatgtttacatgccaactctttctgagccatgtcgccagcgttcattcgtcttatagCCtagacccgtgcgacagtgacccacccacttgaacacccagagcccagaatatcctttctttccagagggccccaggtgctccaggacttccttccctggacccatctccaggcttatgtagtc

This mutation is a 3288 bp deletion beginning at Chromosome 7 position 24,623,679 bp and ending after 24,626,966 bp (GRCm38/mm10). 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
66679 CAT GCC AAC TCT TTC TGA GC Mutant Forward A
66680 GTT CAA GTG GGT GGG TCA CT Mutant Reverse A
66681 ATC TCC CCA TGC CTG TGT T Wild type Forward A
66682 GAT CGT AGC TCA GGG TGC AG Wild type Reverse A
66683 Fluorophore-1 TGT ATT CCG TAT GTT TGG ATT GCT Quencher-1 WT Probe
66684 Fluorophore-2 CGT CTT ATA GCC TAG ACC CGT GCG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
66679 0.40 uM
66680 0.40 uM
66681 0.40 uM
66682 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.