For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr3:158041717+158041823 107bp CTTGAACTACAGTGTGGCCCAGTA TGGGATGATGTAAAGATCTGGTC
Mutant= 110 bp
Wild Type = 107 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
ATCTGTTCTGTGTGTGATATTAAGAGACCACCAGAACTCTGCTGCTGTTGACGCCTCCTCAAGTCAAGTCTGTGTTTGTTTCTTTTCATTTTAGTAATGACTTATTTGTTCACAATTTCTGGACAGCAgtttggtcaatatacacagaataaattactaatcacccaacacattgccatttaatatgaaaaacaggagtttagtaaattattttttttcaatggcaaagctcaactattgctaattgtaagactaagaatattgactttgtcttgtaatcattttagatacatgataatcagctgacatctcttccttcagctataagagagctagacaatcttcagaaacttaatgtcaggtaaagtgtgaacctgtttctaaaactgaaatcccttttcttcacatagaaaataaccttgaactacagtgtggcccagtaggaatcaggcttggttaaacacctgccagatgctgtattctaccCAAGAGGAGAAAACAAGACCAGATCTTTACATCATCCCAGAGAATTTAATGAATCAATTATTTGTTTTC
This mutation is a 358 bp deletion beginning at Chromosome 3 position 158,041,427 bp and ending after 158,041,784 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66656 | TGG GAT GAT GTA AAG ATC TGG TC | Common | A | |||
| 66657 | CTT GAA CTA CAG TGT GGC CCA GTA | Wild type Forward | A | |||
| 66658 | CTC AAG TCA AGT CTG TGT TTG TTT C | Mutant Forward | A | |||
| 66659 | Fluorophore-1 | ACA ATT TCT GGA CAG CAC AAG AGG AG | Quencher-1 | MUT Probe | ||
| 66660 | Fluorophore-2 | TCA GGC TTG GTT AAA CAC CTG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66656 | 0.40 uM |
| 66657 | 0.40 uM |
| 66658 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.