For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 92 bp
Wild Type = 92 bp
>chr7:5018426+5018517 92bp CCTCCTGTGGACTGAGAAGC CAGGCACCATGACTGAACAC
Sequence
Large deletion: Mutant sequence with junction in uppercase
catgtcttactaacttatacagaatgtcttatatggatctcaaaagtctttagaaggaataggtgagatactggggtATcacacatctccctagcttggtgccaaagaaccaatgacttggaacaagcctttgcccaatctgacctccaccagacaagtactacaaaaattttgacctactatgcaaacgtgagtcaaggctccatcctagttaaattcttccaaattctccatagacac
This mutation is a 1202 bp deletion beginning at Chromosome 7 position 5,017,385 bp and ending after 5,018,586 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66632 | CCT CCT GTG GAC TGA GAA GC | Wild type Forward | A | |||
| 66633 | CAG GCA CCA TGA CTG AAC AC | Wild type Reverse | A | |||
| 66634 | Fluorophore-1 | ATC CCT GCC TAC TGA CTT CCA | Quencher-1 | WT Probe | ||
| 66635 | TTA GAA GGA ATA GGT GAG ATA CTG G | Mutant Forward | A | |||
| 66636 | AGA TTG GGC AAA GGC TTG TT | Mutant Reverse | A | |||
| 66637 | Fluorophore-2 | CCC TAG CTT GGT GCC AAA GAA CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66632 | 0.40 uM |
| 66633 | 0.40 uM |
| 66635 | 0.40 uM |
| 66636 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.