Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
chrX:136861232+136861378 147bp CTTGTGCCTCCTCAGTCGTT ACCGGCAGAGCTTTGAGAA
Mutant= 150 bp
Wild Type = 147 bp
Fam=Mut
Hex=Wt
X-LINKED
Large deletion: Mutant sequence with junction in uppercase
actgcaagaaaattgggactgccattggagtatcacataaaaaatgatccagagaccacatcaagtacCAtaatcattacttgacttaaaacacagacagaaaacccttttagtaaaatggggggaaagtgttcttttttatgaggaggtgtcttacctgggcaaggaaaggct
This mutation is a 3744 bp deletion beginning at Chromosome X position 136,858,051 bp and ending after 136,861,794 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66600 | ATT GGG ACT GCC ATT GGA | Mutant Forward | A | |||
| 66601 | CCA GGT AAG ACA CCT CCT CAT | Mutant Reverse | A | |||
| 66602 | CTT GTG CCT CCT CAG TCG TT | Wild type Forward | A | |||
| 66603 | ACC GGC AGA GCT TTG AGA A | Wild type Reverse | A | |||
| 66604 | Fluorophore-1 | ATG GTA CTT GAT GTG GTC TCT GGA TCA | Quencher-1 | MUT Probe | ||
| 66605 | Fluorophore-2 | ATG CAG ATG TAA AGG ACC CAG AT | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66600 | 0.40 uM |
| 66601 | 0.40 uM |
| 66602 | 0.40 uM |
| 66603 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.