Protocol 45847: Probe Assay - Rab9b<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

chrX:136861232+136861378 147bp CTTGTGCCTCCTCAGTCGTT ACCGGCAGAGCTTTGAGAA

Mutant=  150 bp

Wild Type = 147 bp

Fam=Mut

Hex=Wt

X-LINKED

Sequence

Large deletion:  Mutant sequence with junction in uppercase

actgcaagaaaattgggactgccattggagtatcacataaaaaatgatccagagaccacatcaagtacCAtaatcattacttgacttaaaacacagacagaaaacccttttagtaaaatggggggaaagtgttcttttttatgaggaggtgtcttacctgggcaaggaaaggct

This mutation is a 3744 bp deletion beginning at Chromosome X position 136,858,051 bp and ending after 136,861,794 bp (GRCm38/mm10). 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
66600 ATT GGG ACT GCC ATT GGA Mutant Forward A
66601 CCA GGT AAG ACA CCT CCT CAT Mutant Reverse A
66602 CTT GTG CCT CCT CAG TCG TT Wild type Forward A
66603 ACC GGC AGA GCT TTG AGA A Wild type Reverse A
66604 Fluorophore-1 ATG GTA CTT GAT GTG GTC TCT GGA TCA Quencher-1 MUT Probe
66605 Fluorophore-2 ATG CAG ATG TAA AGG ACC CAG AT Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
66600 0.40 uM
66601 0.40 uM
66602 0.40 uM
66603 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.