For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr19:27424369-27424486 118bp TGATCAAATGCAAAACTTCTGG GCATTCCAAATACTATACCCGAAT
Mutant= 95 bp
Wild Type = 118 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AAAAGCTACTAAATACATTGTTTTAGATACATTTTAAATGTATAGACTGGCTAAAAATTGTGATCAAATGCAAAACTTCTGGGAAATTATGGTTTCCCCTTGtagcttctagaatgagattggttctggtgatcgccctttgtactaacttcatattcgggtatagtatttggaatgctaaacacattgaatctggatctagaatcaggagccaagaaacccaagtgggatgacttcaaaaagaagaagaaagagctgaagcagagcaggcagctcagtgacaagaccaactatgacatcgtggttcgagcaaagcacatttgggagagcttgagaaggtacctgagagccacttctctcttatccgaccaagaCAAGGGCAGCAGGAAGAGGTGTCCTCCAGACAGACAGTGCTCTAGGCATCCTGTCTGAGACAAGGGCAGCAAGAAGGGGTGTCCTGCAAACAGACCATGCTCTAGGCAGCAGAGACTGCGCCTGGTTTCTTGGTTGTGTACTGGCAGTCTGCTGTCATGG
This mutation is a 272 bp deletion beginning at Chromosome 19 position 27,424,173 bp and ending after 27,424,444 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66576 | TGA TCA AAT GCA AAA CTT CTG G | Common | A | |||
| 66577 | GCA TTC CAA ATA CTA TAC CCG AAT | Wild type Reverse | A | |||
| 66578 | Fluorophore-1 | CTT CTA GAA TGA GAT TGG TTC TGG TG | Quencher-1 | WT Probe | ||
| 66579 | Fluorophore-2 | CCT TGC AAG GGC AGC AGG A | Quencher-2 | MUT Probe | ||
| 66580 | CAG GAT GCC TAG AGC ACT GTC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66576 | 0.40 uM |
| 66577 | 0.40 uM |
| 66580 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.