For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:53011566+53011668 103bp GACCCACTCTTCTGGGTTCC GTATTCTGCATCCCCATTGC
Mutant= 76 bp
Wild Type = 103 bp
Sequence
Wt Sequence: gacccactcttctgggttccaggaaaattatccCatctttgttcggagactcccaggccatgctggggatggggtttggagttgcaatggggatgcagaatac
Mut Sequence: gacccactcttctgggttccaggaaaattatccCGtggaatagcatgcttgctggctctgagggcgagcttctgta
A 10,576 bp deletion beginning at Chromosome 4 position 53,011,600 bp and ending after 53,022,175 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65541 | GAC CCA CTC TTC TGG GTT CC | Common | A | |||
| 65542 | GTA TTC TGC ATC CCC ATT GC | Wild type Reverse | A | |||
| 65545 | Fluorophore-1 | TCT TTG TTC GGA GAC TCC CA | Quencher-1 | WT Probe | ||
| 66498 | TAC AGA AGC TCG CCC TCA GA | Mutant Reverse | A | |||
| 66499 | Fluorophore-2 | TTA TCC CGT GGA ATA GCA TGC TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65541 | 0.40 uM |
| 65542 | 0.40 uM |
| 66498 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.