For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 110 bp
Wild Type = 120 bp
>chr5:21648737+21648856 120bp TGGGAAATAATGCAGCCTTC GCTGTGAGCACAAGTGGCTA
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case; insertions with carrots ^g^ (g insertion):
AAAGTGTAAGCAGGCGTTCCCACACACTGCACCTCCCTGGTCCTCAGTAGC^ccccccc^gcctcccctcccacgggccagcctccatggctgacaccacttgcatttttaaagccatgaccttccttcttcctcttctcccatctccctcttcctagcagatgccaagatttgtagcttgcctgtcctgtggtttttctcttaacacatgaaaattgtccatgacctttaaaaagccaaacaactgtgcccagtatcagagtatatgtttgaacatttcacacattaacaataaaacacattactggtgagtttcaatgaattctaaatggcttccttcttatgcagaagacctaaccgatggctcctatgacgatatcttaaatgcagagcagcttaagaaacttctgtatctgctggagtcaaccgacgatcctgtcattactgaaaaggccttggtcaccttgggaaataatgcagccttctccactaaccaggtaagcctcctctttccacacaagtagctgtggccccattctgaaCTCTTAGCTATCCTCATATGGCATAGCCACTTGTGCTCACAGCAGTGTTTG
This mutation is a 482 bp deletion beginning at Chromosome 5 position 21,648,332 bp and ending after 21,648,813 bp (GRCm38/mm10).
There is a 7 bp (CCCCCCC) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66324 | TGG GAA ATA ATG CAG CCT TC | Wild type Forward | A | |||
| 66325 | GCC AAA AGA AAA GTG TAA GCA G | Mutant Forward | A | |||
| 66330 | GCT GTG AGC ACA AGT GGC TA | Common | A | |||
| 66331 | Fluorophore-1 | TCC ACA CAA GTA GCT GTG GC | Quencher-1 | WT Probe | ||
| 66332 | Fluorophore-2 | CCC ACA CAC TGC ACC TCC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66324 | 0.40 uM |
| 66325 | 0.40 uM |
| 66330 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.