For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:16458546-16458683 138bp AATGTATTGCACTCAGAGACTGTT CCATTCCCGGAAAATGACTT |
Mutant= 125 bp
Wild Type = 138 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
aatgtattgcactcagagactgttagtaccagcagtacatctaattcctcATtataggaaccatgtcagctttttagtatactttaatactaatttactttaaaattaaaggcacagtgtagcac
This mutation is a 4057 bp deletion beginning at Chromosome 11 position 16,454,576 bp and ending after 16,458,632 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64097 | AAT GTA TTG CAC TCA GAG ACT GTT | Common | A | |||
| 64099 | GTG CTA CAC TGT GCC TTT AAT TTT | Mutant Reverse | A | |||
| 64101 | Fluorophore-1 | CCT CAT TGG GGA CAA GAA AGT | Quencher-1 | WT Probe | ||
| 65707 | Fluorophore-2 | TCC TCA TTA TAG GAA CCA TGT CAG CTT | Quencher-2 | MUT Probe | ||
| 66309 | CCA TTC CCG GAA AAT GAC TT | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64097 | 0.40 uM |
| 64099 | 0.40 uM |
| 66309 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.