For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 116 bp
Wild Type = 98 bp
>chr4:134365004-134365101 98bp ACAGCAGGGGCAACCTCTT AAGGGAGCCTGAGACACCTG
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
ACAGCAGGGGCAACCTCTTGtgattgagggaatgtcactgtaaggtggcaggggccactggagctgcacggtgaggggcaggtgtctcaggctcccttcctgtaccttctcaggacctacccaggagagacccttcccaatgccaccttctgcctcatccctggtcaccgatctgccacctcctgctttctccaagcccttcaggtacaccccaatctggatattccccagcctcagtacctctgcccttgcactggcaggagattctgggcacatgcacataggaagggggttccctgtacccccaaatactcctctttgtcctttcccttaacaggggggctgatggtggcctggggtggtggtgaatgtgtgcaagcgctgggctccccaatgactgccctgccccccaggccggctgcatccccgtgctcctcagcccccgctgggagctgcctttctctgaagtcatcgactggaccaaggcagccatcattgctgatgagagactcccactgcaggtagctcagggtctgtgtcatggtggggggggggaatgtcaggggagggaccccaggatctcggcccccttctagtagtcattcttatacctattgcttccctctagggcagtcatagatgtagttgaagggaaggctctagagggtgctgagagcaagttctgaaccactttcttccttggttttcccatctgtataatgggataagttagatctctagggatcatctgaaagtaaacagataagatgccatgtctcttccatctGATGAAATGAATGTTGCCCAGGCCAGAAGCATCTCTGTGAGCAGCTGT
This mutation is a 767 bp deletion beginning at Chromosome 4 position 134,364,315 bp and ending after 134,365,081 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65440 | ACA GCA GGG GCA ACC TCT T | Wild type Forward | A | |||
| 65441 | AAG GGA GCC TGA GAC ACC TG | Wild type Reverse | A | |||
| 65442 | CCA GGT CAC TGC TCT TGG TTA | Mutant Forward | A | |||
| 65443 | ACA GCT GCT CAC AGA GAT GC | Mutant Reverse | A | |||
| 65446 | Fluorophore-1 | CCA CTG GAG CTG CAC GGT | Quencher-1 | WT Probe | ||
| 66294 | Fluorophore-2 | CCT CTT GGA TGA AAT GAA TGT TGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65440 | 0.40 uM |
| 65441 | 0.40 uM |
| 65442 | 0.40 uM |
| 65443 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.