For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:69799840-69799955 116bp GCAGCAAGGAGTGTGCTCTT GGGAGGACAGGACTGGTACA
Mutant= 88 bp
Wild Type = 116 bp
Sequence
Wt Sequence: gcagcaaggagtgtgctcttttaaGgtctcccctgcttccgctcagcgtggagattgccagtgatttcatgtgggcagcaggttgtacaagacacttgtaccagtcctgtcctccc
Mut Sequence: gcagcaaggagtgtgctcttttaaGGcaggtgggtagtcagggccctgtgactgcttggggccgattctccagcatatccactgtgtc
A 3821 bp deletion beginning at Chromosome 14 position 69,796,110 bp and ending after 69,799,930 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66275 | GCA GCA AGG AGT GTG CTC TT | Common | A | |||
| 66276 | GAC ACA GTG GAT ATG CTG GAG A | Mutant Reverse | A | |||
| 66277 | GGG AGG ACA GGA CTG GTA CA | Wild type Reverse | A | |||
| 66278 | Fluorophore-1 | AGG CAG GTG GGT AGT CAG G | Quencher-1 | MUT Probe | ||
| 66279 | Fluorophore-2 | CAG CGT GGA GAT TGC CAG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66275 | 0.40 uM |
| 66276 | 0.40 uM |
| 66277 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.