For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:117002332+117002427 96bp ACGTGTGCACCTTGTATGTG GGTAGGGGAGGGTGCTAAAG
Mutant= 96 bp
Wild Type = 96 bp
Sequence
Wt Sequence: acgtgtgcaccttgtatgtgcacgtgcacacacatacActtgggtgcataacacccggaggcaagaatctttacttctttagcaccctcccctacc
Mut Sequence: acgtgtgcaccttgtatgtgcacgtgcacacacatacACttggaagtatttgctgtctgcacagcacgctcttccagaggctgatgggaaaagtgt
A 469 bp deletion beginning at Chromosome 10 position 117,002,370 bp and ending after 117,002,838 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66270 | ACG TGT GCA CCT TGT ATG TG | Common | A | |||
| 66271 | GGT AGG GGA GGG TGC TAA AG | Wild type Reverse | A | |||
| 66272 | ACA CTT TTC CCA TCA GCC TCT | Mutant Reverse | A | |||
| 66273 | Fluorophore-1 | TGC ACA CAC ATA CAC TTG GAA GTA T | Quencher-1 | MUT Probe | ||
| 66274 | Fluorophore-2 | CAT AAC ACC CGG AGG CAA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66270 | 0.40 uM |
| 66271 | 0.40 uM |
| 66272 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.