For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 88 bp
Wild Type = 97 bp
>chr14:60282082+60282178 97bp CCGAGAGTACAAGGTAAGCAAG CACGCTGCTCTACAGACTGCT
The mutant forward primer (65235) anneals over the nucleotide sequence containing mouse genomic variation rs214437785.
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
TTTGTTGTAAGTTTCAGATTCAGGTATGTTCATGTCTTAGCCATTTCTTTGAA^A^gaaggggtaagccctgaaaatccgttttatcttgtaaatttcattgtattgacttttactattttgcagcaaaatatgaagatctctatgccttctcttataatcccaagcaaaatgatactgaacgacggaatggttggcagcttattgaccttgctgcggagtatgagaggatgggagtgcccaatgcaaactggcaactgtcggatgccaaccgagagtacaaggtaagcaagcagcctctgcagcaggtcagaggacagtgctgagggcagtgTGGGGCAGTGGTCAGCAGTCTGTAGAGCAGCGTG
This mutation is a 277 bp deletion beginning at Chromosome 14 position 60,281,868 bp and ending after 60,282,144 bp with a single bp A insertion at the deletion site (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65233 | CCG AGA GTA CAA GGT AAG CAA G | Wild type Forward | A | |||
| 65234 | CAC GCT GCT CTA CAG ACT GCT | Common | A | |||
| 65235 | TTC AGG TAT GTT CAT GTC TTA GCC | Mutant Forward | A | |||
| 65236 | Fluorophore-1 | AGG TCA GAG GAC AGT GCT GAG | Quencher-1 | WT Probe | ||
| 66241 | Fluorophore-2 | CCA CTG CCC CAT TTC AAA GAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65233 | 0.40 uM |
| 65234 | 0.40 uM |
| 65235 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.