For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:38574214+38574314 101bp GCTGTGTAAACCCCAGAGC AGGTCCGGCTTAAAAACGAG
Mutant= 99 bp
Wild Type = 101 bp
Sequence
Wt Sequence: gctgtgtaaaccccagagctccgtgccccggctccgattacAaccatgtgtcTggtgttgattgcagGAGGCCAGAGCAAGCTCGTTTTTAAGCCGGACCT
Mut Sequence: gctgtgtaaaccccagagctccgtgccccgatatatatatatgtatacacacacacacacacacatatatatgtatatatgcatttgcctgcacgtatg
This mutation is a 807 bp deletion beginning at Chromosome 16 position 38,753,882 bp and ending after 38,754,688 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64984 | AGG TCC GGC TTA AAA ACG AG | Wild type Reverse | A | |||
| 64985 | ATT CAC TTG CAT ACG TGC AG | Mutant Reverse | A | |||
| 65943 | Fluorophore-1 | TCT GGT GTT GAT TGC AGG AG | Quencher-1 | WT Probe | ||
| 66231 | Fluorophore-2 | CCG TGC CCC GAT ATA TAT ATA TGT ATA C | Quencher-2 | MUT Probe | ||
| 66232 | GCT GTG TAA ACC CCA GAG C | Common | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64984 | 0.40 uM |
| 64985 | 0.40 uM |
| 66232 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.