Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr2:121106770-121106869 100bp GCAGGTAACACCACCTCCTG CTCACTGGATGGGAAATTGG
Mutant= 109 bp
Wild Type = 100 bp
Wt Sequence: GCAGgtaacaccacctcctggagggaggatgggcttgctgggaactgttagctaacaaagggcActgttcgaggtgctggccaatttcccatccagtgag
Mut Sequence: ttcccaaaagtctggagttatctaataattttcatagtctatattttttatagcatagattttgttgctagCActgttcgaggtgctggccaatttcccatccagtgag
A 417 bp deletion beginning at Chromosome 2 position 121,106,807 bp and ending after 121,107,223 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66154 | Fluorophore-1 | CTT GCT GGG AAC TGT TAG CTA AC | Quencher-1 | WT Probe | ||
| 66155 | GCA GGT AAC ACC ACC TCC TG | Wild type Forward | A | |||
| 66156 | CTC ACT GGA TGG GAA ATT GG | Common | A | |||
| 66157 | TTC CCA AAA GTC TGG AGT TAT C | Mutant Forward | A | |||
| 66158 | Fluorophore-2 | TGT TGC TAG CAC TGT TCG AGG T | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66155 | 0.40 uM |
| 66156 | 0.40 uM |
| 66157 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.