Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr6:90412353-90412458 106bp CACAGTTCCGGGTCCTCTAA CTTTCCACAGGAAGGCTGTC
Mutant= 86 bp
Wild Type = 106 bp
Wt Sequence: cacagttccgggtcctctaaaatcaagatccaGcagtggtcatatgggttctctttgcttccagcagGATCTGGCAGTAAGAGCAAGACAGCCTTCCTGTGGAAAG
Mut Sequence: cacagttccgggtcctctaaaatcaagatccaGGggagggtgaggagagggaagacagctgaggccattccacggagctacctcag
A 349 bp deletion beginning at Chromosome 6 position 90,412,077 bp and ending after 90,412,425 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66149 | CAC AGT TCC GGG TCC TCT AA | Common | A | |||
| 66150 | CTT TCC ACA GGA AGG CTG TC | Wild type Reverse | A | |||
| 66151 | CTG AGG TAG CTC CGT GGA AT | Mutant Reverse | A | |||
| 66152 | Fluorophore-1 | TGA GGA GAG GGA AGA CAG CT | Quencher-1 | MUT Probe | ||
| 66153 | Fluorophore-2 | AGT GGT CAT ATG GGT TCT CTT TG | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66149 | 0.40 uM |
| 66150 | 0.40 uM |
| 66151 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.