For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 118 bp
>chr14:55741367-55741484 118bp TCAGGTTTTCCCTTGGAATG GTGAATGCTGGTTCAGTTGC |
Sequence
Wt Sequence (deletions in lower case):
TCAGGTTTTCCCTTGGAATGGCCTATACCTGATTTCCCTGgtcttcagctattgctatgcagcctctatactgaccacagatactgaggacttgagaagcaactgaaccagcattcacacaattcattccttcttcttcttcttcttcttcttccctgaccctgtctagaggccactacttatgctctgtgtatggggcacggctgatggtgccagctggcaaaggactcatcgtgattgtctcctcccctggggggctgcagcatatgttcaatgtcccttatggtgtgggcaaagctgcggtaaggatcaaggcacaggagttggggggtacacagcagtgttgacggttggtaatgGTCCACAGCTGTCAGAGTAGTAAGACCTTCACCTCTCCCTCCCCCCCCCCCTCTCTCTCTGTCCCATGC
This mutation is a 319 bp deletion beginning at Chromosome 14 position 55,741,126 bp and ending after 55,741,444 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66077 | TCA GGT TTT CCC TTG GAA TG | Common | A | |||
| 66078 | GTG AAT GCT GGT TCA GTT GC | Wild type Reverse | A | |||
| 66079 | GCA TGG GAC AGA GAG AGA GG | Mutant Reverse | A | |||
| 66080 | Fluorophore-1 | TCT TCA GCT ATT GCT ATG CAG CC | Quencher-1 | WT Probe | ||
| 66081 | Fluorophore-2 | TGA TTT CCC TGG TCC ACA GCT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66077 | 0.40 uM |
| 66078 | 0.40 uM |
| 66079 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.